CnDatabase_Nourseothricin_resistance 1 NAT (Nourseothricin Resistance/NrsR) Organism: Cryptococcus neoformans serotype A H99S strain 2022-06-20T00:13:47 Plasmid <a href="https://www.addgene.org/92085/">YSBE 557 (#92085)</a> We deleted the restriction enzyme sequence of NotI and added the atg codon the beginning of the sequence. This is the coding sequence of the Nourseothricin Resistance gene (NAT/NrsR). 11270405 27780958 CnDatabase_Nourseothricin_resistanceSequence 1 atgactcttgacgacacggcttaccggtaccgcaccagtgtcccgggggacgccgaggccatcgaggcactggatgggtccttcaccaccgacaccgtcttccgcgtcaccgccaccggggacggcttcaccctgcgggaggtgccggtggacccgcccctgaccaaggtgttccccgacgacgaatcggacgacgaatcggacgacggggaggacggcgacccggactcccggacgttcgtcgcgtacggggacgacggcgacctggcgggcttcgtggtcgtctcgtactccggctggaaccgccggctgaccgtcgaggacatcgaggtcgccccggagcaccgggggcacggggtcgggcgcgcgttgatggggctcgcgacggagttcgcccgcgagcggggcgccgggcacctctggctggaggtcaccaacgtcaacgcaccggcgatccacgcgtaccggcggatggggttcaccctctgcggcctggacaccgccctgtacgacggcaccgcctcggacggcgagcaggcgctctacatgagcatgccctgcccctaa CnDatabase_Nourseothricin_resistance_SBOLDesignerActivity 1 Sophia Garcia de Resende 2021-12-13T21:16:02.486Z Association 1 SBOL_Software_SBOLDesigner 3.1 SBOLDesigner CAD Tool SBOLDesigner is a simple, biologist-friendly CAD software tool for creating and manipulating the sequences of genetic constructs using the Synthetic Biology Open Language (SBOL) 2 data model. Throughout the design process, SBOL Visual symbols, a system of schematic glyphs, provide standardized visualizations of individual parts. SBOLDesigner completes a workflow for users of genetic design automation tools. It combines a simple user interface with the power of the SBOL standard and serves as a launchpad for more detailed designs involving simulations and experiments. Some new features in SBOLDesigner are the ability to add variant collections to combinatorial derivations, enumerating those collections, and the ability to view sequence features hierarchically. There are also some small changes to the way that preferences work in regards to saving a design with incomplete sequences. Samuel Bridge Sean Sleight Michael Zhang Michal Galdzicki John Gennari Chris Myers Evren Sirin Bryan Bartley