CnDatabase_GenBank_CM000046_Region_303006_303540 1 URA5 Organism: Cryptococcus neoformans var. neoformans B-3501A 2022-06-20T01:04:05 GenBank: <a href="https://www.ncbi.nlm.nih.gov/nuccore/CM000046?report=genbank&log$=nuclalign&blast_rank=1&RID=VA11PB9N016&from=303006&to=303540">CM000046 Region: 303006..303540</a> The Ura5 terminator (M34606) given by the reference has some SNPs compared to the genomic sequence (CM000046) present in this database. This is the terminator of the Orotidine Monophosphate Pyrophosphorylase. 2201894 CnDatabase_GenBank_CM000046_Region_303006_303540Sequence 1 gggttttcttcttaaatgcacgggtttaggtctagctaatcaagttccgacatattacaagtttgtaagcttgtatcaaaggaacttaagtacaggcaggcgtgctgaggcgacaaaggaagctgtaatatgattgttggctgtcaatcttcatcgtatctactttgtcaatactgacttcaatgacccaataatacaattttattagtgttgacccagaatggttagcaggaaactccccttctcttcctctcaatcccaatcatacttcatatctcctgctccccccatttccgtcttcctcgatgactccctggtcccatccctcccacctcctggaggcaagctggagcacctggacctaatgggtcgtcgccccaaattgcctccacctcttaagacaatcatcgtccaatcaaactctgaactatcttccaagccaatggccggatctggacacaagatgatgtcgaagccgcttgatgtgccagggttggtccgtggcctggagacacgtagagcgggtagtctggga CnDatabase_GenBank_CM000046_Region_303006_303540_SBOLDesignerActivity 1 Sophia Garcia de Resende 2021-12-11T20:25:23.374Z Association 1 SBOL_Software_SBOLDesigner 3.1 SBOLDesigner CAD Tool SBOLDesigner is a simple, biologist-friendly CAD software tool for creating and manipulating the sequences of genetic constructs using the Synthetic Biology Open Language (SBOL) 2 data model. Throughout the design process, SBOL Visual symbols, a system of schematic glyphs, provide standardized visualizations of individual parts. SBOLDesigner completes a workflow for users of genetic design automation tools. It combines a simple user interface with the power of the SBOL standard and serves as a launchpad for more detailed designs involving simulations and experiments. Some new features in SBOLDesigner are the ability to add variant collections to combinatorial derivations, enumerating those collections, and the ability to view sequence features hierarchically. There are also some small changes to the way that preferences work in regards to saving a design with incomplete sequences. Samuel Bridge Sean Sleight Michael Zhang Michal Galdzicki John Gennari Chris Myers Evren Sirin Bryan Bartley